Children's Oncology Group (COG) Cell Culture and Xenograft Repository

Data Archive

TaqMan RT-PCR primers and probes

Table 1. List of real-time RT-PCR primer and probe sets from Applied Biosystems.

Gene

Company

Hs number

PDK11

Applied Biosystems

Hs01561850_m1

LDHA

Applied Biosystems

Hs00855332_g1

TPI1

Applied Biosystems

Hs01593134_gH

B2M

Applied Biosystems

Hs00984230_m1


1The probe for each gene was labeled with a reporter fluorescent dye, FAM (6-carboxy-fluorescein), on the 5' nucleotide and a quenching dye, minor groove binder (MGB), on the 3' nucleotide.

Table 2. List of real-time RT-PCR primers and probe from Integrated DNA Technologies.

Gene

Company

GeneBank

Forward Primer

Reverse Primer

Probe1

ALDOC

Integrated DNA Technologies

AY893600.1

TGCCTATTGTGGAACCTGAAATA

CTTGTACACAGCAGCCAAGA

TGATGGAGACCACGACCTCAAACG


1The probe was labeled with FAM on the 5' nucleotide and the quenching dye Iowa Black on the 3' nucleotide.